Mopo16S¶
Mopo16s input data can be created using the ITSoneWB tool Prepare primer input inference.
Galaxy usage¶
The tool provides four outputs:
init primers:
init scores:
output primers:
output scores:
Reference primer pair¶
The reference primer pair can be loaded by the Galaxy History or the user can use the built in pair.
Currently, the reference primer pair is:
>forward
GAACCWGCGGARGGATCA
>reverse
GCTGCGTTCTTCATCGATGC
This reference primer pair can be downloaded here.
Advanced options¶
All Mopo16s options are parsed by our Galaxy wrapper and hidden under the advanced menu option:
All Mopo16s option are listed and explained here. Moreover each option help is reported in the tool in-line help.
Install on Galaxy¶
Galaxy is able to automatically solve conda dependecies when a tool is started.
To install Mopo16s on Galaxy:
Clone the ITSoneWb repository
git clone https://github.com/ibiom-cnr/itsonewb.git
Add the Mopo16s entry in the galaxy
tool_conf.xmlfile with your favourite editor:<section name="Primer Design" id="primer_design"> <tool file="/path/to/itsonewb/mopo16s_wrapper/mopo16s_wrapper.xml" /> </section>
Add the reference primer pair using the
.locfiles. To include them in Galaxy, please refer to the Galaxy Project documnetation. The*locfiles are on our github repository (mopo16s_wrapper/tool-data) with the correspondingtool_data_table_conf.xmlentry.Finally restart Galaxy.
Command line usage¶
Please refer to Mopo16S official documentation here, to run Mopo16S as command line tool.
In the follwing you can find an example on how to run Mopo16S. In particular the reference_set.fasta is the output of the Prepare primer input inference tool, while the mopo16s_initial_primer_pairs_file.fa can be downloaded here.
mopo16s reference_set.fasta mopo16s_initial_primer_pairs_file.fa
Install as standalone tool¶
Please follow the instructions here to install Mopo16S.
ITSoneWB is currently using SeqAn 2.1.1.
Docker usage¶
The tool is also packaged as Docker Container, hosted on DockerHub.
You can pull it from DockerHub with the following command:
docker pull ibiomcnr/mopo16s
Mopo16S is built using seqan v2.1.1``and inside the Docker container is available at ``/opt/mopo16s.
# docker run -it ibiomcnr/mopo16s ls -l /opt/mopo16s
total 156
-rw-rw-r--. 1 root root 100710 Feb 6 2017 Doxyfile
-rw-rw-r--. 1 root root 35142 Feb 6 2017 LICENSE
-rw-rw-r--. 1 root root 274 Feb 6 2017 Makefile
-rw-rw-r--. 1 root root 606 May 12 16:21 Makefile.rules
-rw-rw-r--. 1 root root 1688 Jul 26 2017 README.md
drwx------. 2 root root 86 Jul 26 2017 data
drwx------. 2 root root 22 Jul 26 2017 debug
drwx------. 2 root root 22 Jul 26 2017 profile
drwx------. 2 root root 4096 May 12 16:21 release
drwx------. 2 root root 4096 Apr 5 2018 src
Note
The primer reference pair can be downloaded here.
Mopo16S executable are in /opt/mopo16s/release. This path has been added to the $PATH, therefore you can call mopo16s, easily, with:
# docker run -it ibiomcnr/mopo16s mopo16s
No reference set file name provided
Copyright (c) 2015 Francesco Sambo and Giacomo Baruzzo, Dept. of Information Engineering,
University of Padova, Italy
mopo16s V1.0: optimal multi-objective design of forward and reverse primer
sets for metagenomics studies.
Usage: mopo16s [OPTIONS] reference_set_file initial_primer_pairs_file
reference_set_file is a .fasta file containing the reference set of
sequences for which the primer are designed.
initial_primer_pairs_file is a .fasta file containing a set of (possibly
degenerate) primer pairs from which to start the optimisation, saved
alterning the forward and its corresponding reverse primer.
Common options:
-s, --seed=LONG Seed of the random number generator (default 0)
-r, --restarts=INT Number of restarts for each run of the multi-objective
optimisation algorithm (default 20)
-R, --runs=INT Number of runs of the multi-objective
optimisation algorithm (default 20)
-o, --outFileName=FNAME Root name of the output files (default "out")
-I, --outInitFileName=FNAME Root name of the files where the initial good
primer pairs should be saved (default "init")
-G, --threads=INT Number of threads for parallel execution (default 1)
-V, --verbose=INT Verbosity level (default 0). If 0, no extra
output would be created. If not 0, for each
run would be created 3 files:
1) primers scores file
2) primers sequences file
3) optimization steps performed at each restart
-h, --help Print this help and exit
Coverage-related options:
-M, --maxMismatches=INT Maximum number of mismatches between the
non-3'-end of the primer and a 16S sequence to
consider the latter covered by the primer, in
case also the 3'-end perfectly matches
(default 2)
-S, --maxALenSpanC=INT Maximum amplicon length span considered when
computing coverage (half above, half below
median) (default 200)
Efficiency-related options:
-l, --minPrimerLen=INT Minimum primer length (default 17)
-L, --maxPrimerLen=INT Maximum primer length (default 21)
-m, --minTm=INT Minimum primer melting temperature (default 52)
-c, --minGCCont=DOUBLE Minimum primer GC content (default 0.5)
-C, --maxGCCont=DOUBLE Maximum primer GC content (default 0.7)
-D, --maxDimers=INT Maximum number of self-dimers, ie of dimers
between all possible gap-less alignments of the
primer with its reverse complement (default 8)
-p, --maxHomopLen=INT Maximum homopolymer length (default 4)
-d, --maxDeltaTm=INT Maximum span of melting temparatures for the
primer sets (default 3)
-e, --maxALenSpanE=INT Maximum span (maxALenSpanE) between median and
-q, --maxALenSpanEQ=DOUBLE given quantile (maxALenSpanEQ) of amplicon
length (default 50 and 0.01, respectively)
Fuzzy tolerance intervals for efficiency-related options:
-t, --minTmInterv=INT Fuzzy tolerance interval for minimum melting
temperature (default 2)
-g, --minGCContInt=DOUBLE Fuzzy tolerance interval for minimum GC
content (default 0.1)
-i, --maxDimersInt=INT Fuzzy tolerance interval for maximum number of
self dimers (default 3)
-T, --deltaTmInt=INT Fuzzy tolerance interval for span of melting
temperatures of the primer set (default 2)
-P, --maxHLenInt=INT Fuzzy tolerance interval for maximum
homopolymer length (default 2)
-E, --maxALenSpanEI=INT Fuzzy tolerance interval for maximum span
between median and given quantile amplicon
length (default 50)
Mandatory arguments to long options are also mandatory for any corresponding
short options.
Mopo16S options are listed here.
Input data needs to be mounted in /data directory, inside the docker container using the -v option.
In the following we show how to use the dockerized version of mopo16S:
# docker run -it -v $PWD/docker_test/mopo16s:/data ibiomcnr/mopo16s mopo16s reference_set.fasta mopo16s_initial_primer_pairs_file.fa
Read reference set
Read initial primer pairs
Saving the initial primer pairs in init.primers
Saving scores of the primer pairs in init.scores
Run #1 started at Tue May 25 05:54:42 2021
Run #1 completed at Tue May 25 05:54:43 2021
Run #2 started at Tue May 25 05:54:43 2021
Run #2 completed at Tue May 25 05:54:43 2021
Run #3 started at Tue May 25 05:54:43 2021
Run #3 completed at Tue May 25 05:54:44 2021
Run #4 started at Tue May 25 05:54:44 2021
Run #4 completed at Tue May 25 05:54:44 2021
Run #5 started at Tue May 25 05:54:44 2021
Run #5 completed at Tue May 25 05:54:45 2021
Run #6 started at Tue May 25 05:54:45 2021
Run #6 completed at Tue May 25 05:54:45 2021
Run #7 started at Tue May 25 05:54:45 2021
Run #7 completed at Tue May 25 05:54:46 2021
Run #8 started at Tue May 25 05:54:46 2021
Run #8 completed at Tue May 25 05:54:46 2021
Run #9 started at Tue May 25 05:54:46 2021
Run #9 completed at Tue May 25 05:54:47 2021
Run #10 started at Tue May 25 05:54:47 2021
Run #10 completed at Tue May 25 05:54:47 2021
Run #11 started at Tue May 25 05:54:47 2021
Run #11 completed at Tue May 25 05:54:48 2021
Run #12 started at Tue May 25 05:54:48 2021
Run #12 completed at Tue May 25 05:54:49 2021
Run #13 started at Tue May 25 05:54:49 2021
Run #13 completed at Tue May 25 05:54:49 2021
Run #14 started at Tue May 25 05:54:49 2021
Run #14 completed at Tue May 25 05:54:50 2021
Run #15 started at Tue May 25 05:54:50 2021
Run #15 completed at Tue May 25 05:54:50 2021
Run #16 started at Tue May 25 05:54:50 2021
Run #16 completed at Tue May 25 05:54:51 2021
Run #17 started at Tue May 25 05:54:51 2021
Run #17 completed at Tue May 25 05:54:51 2021
Run #18 started at Tue May 25 05:54:51 2021
Run #18 completed at Tue May 25 05:54:52 2021
Run #19 started at Tue May 25 05:54:52 2021
Run #19 completed at Tue May 25 05:54:52 2021
Run #20 started at Tue May 25 05:54:52 2021
Run #20 completed at Tue May 25 05:54:53 2021
Saving primer pairs from the final Pareto Front in out.primers
Saving scores of the primer pairs in out.scores
where ``/path/to/data`` is the local path of your data.
The first input, reference_set.fasta is the output of the Prepare input reference file tool, while the mopo16s_initial_primer_pairs_file.fa is the reference prime paire described in the previous sections.
Both the inputs have to be moved in the local /path/to/the/data directory.